rs11128764 chr3:15861329 G>C
- Sequence
ttcaactccagcagataaaataga[G/C]atactatttgtcacccaacccctc
- ASB in cell types
- HEK293 (embryonic kidney) embryonic stem cells derived definitive endoderm
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.10 | 0.63 | 1.87 | |||
| embryonic stem cells derived definitive endoderm | 1.65 | -1.91 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Cells_Cultured_fibroblasts, Liver, Muscle_Skeletal, Nerve_Tibial, Pituitary, Testis, Thyroid, Whole_Blood