rs11130215 chr3:4984323 A>G
- Sequence
tctgctccccacccctgcctcgga[A/G]gaataaagagaatgtagttcccta
- ASB in cell types
- GM01310 ( Transformed lymphovlasoid cell line ) MOLT-4 (Adult T acute lymphoblastic leukemia) HCASMC (Human coronary artery smooth muscle cells)
- ASB for transcription factors
- AHR_HUMAN TCF21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| AHR_HUMAN | -0.53 | 1.89 | 1.00 | n/a | No Hit | |||
| TCF21_HUMAN | -2.26 | 2.38 | 4.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol, mitral annular calcium, prop taste detection threshold, salmonella-induced pyroptosis, total cholesterol change with statins