rs11130485 chr3:55899965 C>G
- Sequence
caggtaaacatagcctctaaagga[C/G]aggtatgaagcagtcctccagaaa
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines) GM18526 (B – cells Lymphoblastoid Cell Lines) HeLa (cervical adenocarcinoma) Kelly (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18486 (Lymphoblastoid Cell Lines) | 3.15 | -2.82 | 1.00 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | -1.71 | 2.85 | 1.00 | |||
| HeLa (cervical adenocarcinoma) | -0.36 | 1.66 | 1.50 | |||
| Kelly (neuroblastoma) | -1.74 | 1.86 | 1.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | 1.19 | 0.21 | 1.00 |
Items per page:
1 – 5 of 7