rs11130703 chr3:59372464 T>C
- Sequence
tccagggaagttagaaaaaaaaac[T/C]tcagagctgtctactttgtgaaca
- ASB in cell types
- CD14+ monocytes
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD14+ monocytes | 1.98 | -1.26 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP salmonella-induced pyroptosis, suicide attempts in bipolar disorder, suicide attempts in mood disorder patients, urinary albumin-to-creatinine ratio