rs11130848 chr3:61561242 G>A
- Sequence
tgcgcggaggatctcgccaaaccc[G/A]agcaccgtgcggcgtcttttaaga
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) LNCaP C4-2 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.89 | 0.64 | 1.14 | |||
| LNCaP C4-2 (prostate carcinoma) | 2.26 | 0.60 | 1.00 |
Items per page:
1 – 2 of 2