rs11132242 chr4:184400787 A>G
- Sequence
ggtaagtcatgatgtttcatggcc[A/G]ttttaatttgaaggtccctaaggt
- ASB in cell types
- foreskin keratinocyte TTC-1240 (Rhabdoid tumor of the kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -0.60 | 1.57 | 1.50 | |||
| TTC-1240 (Rhabdoid tumor of the kidney) | 1.13 | 0.20 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, chronic kidney disease, total cholesterol, total cholesterol change with statins