rs11132276 chr4:185096396 A>G
- Sequence
aggaaataaaatgatgaattttta[A/G]tattataatttcaaattcaggaaa
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) 2588 (Lymphoblastoid Cell Lines) H929 (plasma cell myeloma) MCF10AT1 (breast premetastatic epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | -0.15 | 1.96 | 1.00 | |||
| 2588 (Lymphoblastoid Cell Lines) | 1.29 | -0.65 | 1.00 | |||
| H929 (plasma cell myeloma) | -1.57 | 2.12 | 1.00 | |||
| MCF10AT1 (breast premetastatic epithelial cells) | 2.17 | n/a | 1.00 |
Items per page:
1 – 4 of 4