rs11132810 chr4:169612949 A>C
- Sequence
gagaaagggacttttttattttac[A/C]tgaaagcgcactacttagggatgc
- ASB in cell types
- foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 3.19 | n/a | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood