rs11134765 chr5:172902872 T>G
- Sequence
aggcaggaatctgaactatttaag[T/G]gctcttcaaaaagcaaataaaatt
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) A549 (lung carcinoma) HASM2 (Human airway smooth muscle 2)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | 3.15 | -3.29 | 1.00 | |||
| A549 (lung carcinoma) | 0.70 | 0.21 | 2.02 | |||
| HASM2 (Human airway smooth muscle 2) | 0.63 | 1.50 | 1.00 |
Items per page:
1 – 3 of 3