rs11134877 chr5:174793947 T>C
- Sequence
ggcgaaatctggttttgattcaat[T/C]agattaagttcaggggcagggagg
- ASB in cell types
- RWPE1 (prostate epithelial cells) CD34+ hematopoietic stem cells-derived proerythroblasts CD34+ hematopoietic stem cells MDA-MB-231-1833 (breast cancer cells, bone-tropic metastatic line)
- ASB for transcription factors
- GATA1_HUMAN CDN1B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | -4.99 | 2.91 | 2.00 | 1.17 | Weak Concordant | |||
| CDN1B_HUMAN | 1.57 | -0.38 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
