rs11134885 chr5:157671438 A>G
- Sequence
gcgtccgtggccgccggactctgc[A/G]cgcatgtccaacagcccccgtccc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) SMMC-7721 (hepatocellular carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.55 | 1.11 | 1.09 | |||
| SMMC-7721 (hepatocellular carcinoma) | -0.86 | 1.93 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Heart_Left_Ventricle, Muscle_Skeletal, Testis