rs11136016 chr8:27855358 G>A
- Sequence
ctgcccttgtcagcctcccaaagt[G/A]ttgagattacaggcatgagccacc
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ hematopoietic stem cells-derived proerythroblasts | -1.62 | 2.39 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Colon_Transverse, Liver, Muscle_Skeletal, Nerve_Tibial, Pancreas, Testis, Whole_Blood