rs11136785 chr8:4865525 A>C
- Sequence
aaacatgatgcaacaatatattag[A/C]aaatcacttggagaagaatgtcgc
- ASB in cell types
- MSC (mesenchymal stem cells)
- ASB for transcription factors
- CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | 0.07 | 2.23 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, hypertension (early onset hypertension), neuroblastoma (brain cancer), obesity with early age of onset (age >2), transmission distortion