rs11137568 chr9:78239692 G>A
- Sequence
cggatccacctgcagttttccagt[G/A]cccggcaggtgtcaggcttagatg
- ASB in cell types
- pancreas thyroid gland neural progenitors esophagus squamous epithelium
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.48 | 0.51 | 1.22 | -1.09 | Weak Concordant | |||
| RAD21_HUMAN | 2.34 | -0.70 | 1.12 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP alzheimers disease (apoe4 negative), lp-pla2 mass, refractive error, triglycerides change with statins
GTEx eQTL Brain_Cerebellum, Cells_EBV-transformed_lymphocytes, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid