rs11138157 chr9:79360865 G>C
- Sequence
gaagagtgtgccaaataactctgt[G/C]gacctaggaattcctgatacaatg
- ASB in cell types
- LHSAR (prostate epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LHSAR (prostate epithelial cells) | 2.37 | n/a | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP height, major depressive disorder (narrow definition), major depressive disorder (narrow definition) (males)