rs11138830 chr9:69470540 C>T
- Sequence
cacaaaaatgatgcaaataattta[C/T]gatgattcaagagagaaacctaag
- ASB in cell types
- YCC3 (gastric adenocarcinoma)
- ASB for transcription factors
- HNF4A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HNF4A_HUMAN | 2.71 | 0.05 | 1.75 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, ldl cholesterol, lp-pla2 mass, systolic blood pressure (sbp), total cholesterol