rs11139750 chr9:82758136 C>A
- Sequence
gtggcaactactcaactcagctca[C/A]atagttgaaagcagtcacagacaa
- ASB in cell types
- LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | 0.77 | -0.31 | 1.29 |
Items per page:
1 – 1 of 1