rs11142275 chr9:88388828 T>C
- Sequence
cccgccaacatggccgccaccctc[T/C]cgtccccagttccccggccgccgc
- ASB in cell types
- CUTLL1 (T-cell lymphoblastic lymphoma 1) breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CUTLL1 (T-cell lymphoblastic lymphoma 1) | 2.27 | 0.07 | 2.00 | |||
| breast tumor | 2.60 | -1.82 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Colon_Transverse, Esophagus_Mucosa, Muscle_Skeletal, Pancreas, Skin_Sun_Exposed_Lower_leg, Whole_Blood