rs11144728 chr9:76044631 T>C
- Sequence
cagtgcaacccttttgtaataact[T/C]ttggtattagagctaatttagaga
- ASB in cell types
- adipose
- ASB for transcription factors
- PPARG_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PPARG_HUMAN | 0.41 | 2.62 | 1.33 | -2.59 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP fasting blood glucose, hdl cholesterol, ldl cholesterol change with statins, obesity with early age of onset (age >2), salmonella-induced pyroptosis, total cholesterol change with statins