rs11145075 chr9:76799658 C>A
- Sequence
actttgatccatgagtatattaag[C/A]ctgggttgtcagggcaataaaatt
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.11 | 0.42 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease (left hippocampal grey matter density), alzheimers disease (right hippocampal grey matter density), irritible bowel syndrome, tetrology of fallot, type 1 diabetes, gender differentiated