rs11146053 chr10:132940535 A>G
- Sequence
aagaaggaaccgtggggaaggaga[A/G]ggcgccctgggggtgcgcccgggg
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines) epithelial cell of prostate GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.95 | 0.32 | 1.42 | 2.17 | Discordant | |||
| STAG1_HUMAN | 2.20 | 0.73 | 1.20 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
