rs11146577 chr10:132904621 A>G
- Sequence
acggccagggcgcccagcccccac[A/G]tcctcctgttgtgtgccgctctgc
- ASB in cell types
- GM18526 (B – cells Lymphoblastoid Cell Lines) GM02610 (Lymphoblastoid Cell Lines) SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18526 (B – cells Lymphoblastoid Cell Lines) | 1.47 | -1.19 | 1.00 | |||
| GM02610 (Lymphoblastoid Cell Lines) | 0.93 | -1.58 | 1.33 | |||
| SK-N-SH (neuroblastoma) | -0.76 | 1.90 | 1.00 |
Items per page:
1 – 3 of 3