rs11149680 chr16:84747301 C>T
- Sequence
ggaacacctgacacccttcattac[C/T]aggatgtagcagcaagctgccaaa
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 1.97 | -4.43 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, autism with low iq, normoxic and mild-hypoxic adaptation in populations residing at low and moderate altitudes, tetrology of fallot