rs11152027 chr18:57675277 C>T
- Sequence
gagggaaaattcccataatcccac[C/T]atccacaggagaaacaacaggtgt
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- TF65_HUMAN NOTC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 1.82 | -0.39 | 2.50 | n/a | No Hit | |||
| NOTC1_HUMAN | 1.43 | n/a | 3.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP late onset alzheimers disease, response to lithium treatment for bipolar disorder, rheumatoid arthritis, sporadic creutzfeldt-jakob disease