rs11152206 chr18:55093698 T>C
- Sequence
agacaaatactgtaagaagaaaat[T/C]aagaagccattggtttccacccac
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 1.11 | 0.12 | 1.11 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP biploar disorder (bipolar schizoaffective disorder), bipolar disorder, hdl cholesterol change with statins, infant head circumference, major depressive disorder, obesity with early age of onset (age >2), total cholesterol change with statins