rs11153075 chr6:107704804 C>T
- Sequence
ggtcagagttagaggcagatggtg[C/T]tgagggggttgtccctgcagagac
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM19239 (male B-cells lymphoblastoid cell line)
- ASB for transcription factors
- IKZF2_HUMAN COT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF2_HUMAN | 2.11 | -0.40 | 1.00 | n/a | n/a | |||
| COT1_HUMAN | 2.33 | -2.17 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2