rs11153238 chr6:110497644 G>A
- Sequence
tgctcatctctcatcaatagcagc[G/A]caacacttcagagactgggagagg
- ASB in cell types
- macrophages form periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages form periferal blood | 2.13 | -1.40 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration (geographic atrophy), hypertension (early onset hypertension), imprinting effects on cleft lip without cleft palate, mitral annular calcium
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Esophagus_Gastroesophageal_Junction, Lung, Nerve_Tibial, Thyroid, Whole_Blood