rs11153277 chr6:111259358 C>A
- Sequence
ttgctggagagcgagcgtcttttg[C/A]cacgaacacctgcggcgtgccgaa
- ASB in cell types
- foreskin keratinocyte HepG2 (hepatoblastoma) CD34+ hematopoietic stem cells-derived proerythroblasts adult erythroblasts
- ASB for transcription factors
- TYY1_HUMAN GATA1_HUMAN HCFC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TYY1_HUMAN | 2.42 | -0.40 | 1.83 | n/a | No Hit | |||
| GATA1_HUMAN | -1.21 | 2.23 | 2.00 | n/a | No Hit | |||
| HCFC1_HUMAN | n/a | 2.32 | 3.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, chronic kidney disease, coronary artery disease (cad), refractive error, sporadic creutzfeldt-jakob disease, triglycerides, triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Minor_Salivary_Gland, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood