rs11153451 chr6:113873358 A>G
- Sequence
ctcactcggcagctggcttccccc[A/G]ggtccgaagttcaagagactttca
- ASB in cell types
- macrophages form periferal blood GM02255 (Lymphoblastoid Cell Lines) CD14+ monocytes
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages form periferal blood | -0.45 | 2.72 | 2.00 | |||
| GM02255 (Lymphoblastoid Cell Lines) | -1.30 | 1.80 | 1.00 | |||
| CD14+ monocytes | 2.21 | -1.25 | 2.00 |
Items per page:
1 – 3 of 3