rs11153609 chr6:116307783 G>A
- Sequence
cccatgctgcacaaggaaagaagt[G/A]tgtacaagataattccaaagggca
- ASB in cell types
- liver
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| liver | 1.56 | -0.61 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol change with statins, lung function, forced expiratory volume in 1 second (fev1), serum creatinine, total cholesterol, triglycerides
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pancreas, Testis, Thyroid, Whole_Blood