rs11154068 chr6:95648871 C>G
- Sequence
agcctgttgatggggtggggaagg[C/G]agagcatcaggaagaacagcaaat
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) WA01 (H1, human embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | -0.05 | 2.04 | 1.00 | |||
| WA01 (H1, human embryonic stem cells) | 2.67 | 0.28 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Nerve_Tibial, Whole_Blood