rs11154343 chr6:126091807 C>T
- Sequence
gctatctctcagtctaaagaatgc[C/T]gtgcagcttgatgacacattgatt
- ASB in cell types
- iPS-derived chondrocytes
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| iPS-derived chondrocytes | 0.80 | 0.10 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, hip bone mineral density (bmd), ldl cholesterol change with statins, primary rhegmatogenous retinal detachment, salmonella-induced pyroptosis, total cholesterol change with statins, waist hip ratio
GTEx eQTL Brain_Cerebellum, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Heart_Left_Ventricle