rs11156978 chr14:21456514 G>C
- Sequence
aaagaatgtgaagaccctgtcggt[G/C]ttctgtccgactatctaggtccag
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) A549 (lung carcinoma) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.84 | 0.62 | 1.12 | |||
| A549 (lung carcinoma) | 0.09 | 1.05 | 2.03 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.96 | 0.21 | 1.43 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, birth weight
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid