rs11158107 chr14:56474456 A>C
- Sequence
tgaacttgtgatattttaatgttt[A/C]ataaatattgtgatatacaattcg
- ASB in cell types
- HMEC (human mammary epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HMEC (human mammary epithelial cells) | 2.15 | -1.95 | 1.00 |
Items per page:
1 – 1 of 1