rs11158109 chr14:56474646 G>A
- Sequence
tttgaccaaagttaatactgcaga[G/A]ataaaagctacattccgtagaaat
- ASB in cell types
- foreskin keratinocyte spleen CD20+ HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.34 | n/a | 2.67 | |||
| spleen | 1.67 | 0.81 | 1.00 | |||
| CD20+ | 2.66 | -1.87 | 2.00 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 1.36 | -0.65 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder in alcoholics, chronic kidney disease, major depressive disorder, serum creatinine