rs11158729 chr14:68309343 T>C
- Sequence
tttttaaagtaaaagccaagtcaa[T/C]ggcactggtacttgtagtgaaatg
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) MDM(monocyte derived macrophages)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CTV-1 (Adult T acute lymphoblastic leukemia) | 1.29 | 0.39 | 1.00 | |||
| MDM(monocyte derived macrophages) | 0.65 | 2.20 | 2.33 |
Items per page:
1 – 2 of 2