rs11158764 chr14:68787538 G>T
- Sequence
tagcttatagggatgagagatgcc[G/T]ccacccacagccacagccctctct
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney) CTV-1 (Adult T acute lymphoblastic leukemia) 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| TTC-1240 (Rhabdoid tumor of the kidney) | -0.23 | 2.49 | 1.50 | |||
| CTV-1 (Adult T acute lymphoblastic leukemia) | 1.14 | -0.24 | 1.00 | |||
| 22RV1 (prostate carcinoma) | 1.88 | -0.89 | 2.50 |
Items per page:
1 – 3 of 3