rs11159998 chr14:91269839 A>T
- Sequence
cagagggacaaagaagcgtgcagc[A/T]gaggctaagggtgccaagaagtgc
- ASB in cell types
- adipose
- ASB for transcription factors
- PPARG_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PPARG_HUMAN | 0.85 | 2.77 | 1.75 | 2.35 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
