rs11160188 chr14:94532692 C>T
- Sequence
tttctatgaccaacaggatgtggc[C/T]tttttgttttcgtaatgaagaatc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) 22RV1 (prostate carcinoma)
- ASB for transcription factors
- IKZF2_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF2_HUMAN | -2.23 | 2.36 | 1.00 | n/a | n/a | |||
| ANDR_HUMAN | -1.98 | 2.44 | 2.00 | -3.83 | Discordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy)