rs11160205 chr14:94689667 C>T
- Sequence
ccagggaagcgccgtccccgcacc[C/T]gccacgaggcggcgccagagcagc
- ASB in cell types
- HEK293 (embryonic kidney) WA09 (embryonic stem cells) KB (cervical adenocarcinoma) HMEC (human mammary epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.12 | 1.05 | 1.99 | |||
| WA09 (embryonic stem cells) | 3.08 | 0.94 | 1.43 | |||
| KB (cervical adenocarcinoma) | 2.01 | -0.69 | 2.00 | |||
| HMEC (human mammary epithelial cells) | 2.81 | -4.28 | 1.33 | |||
| neural progenitors | 0.37 | 1.60 | 1.00 |
Items per page:
1 – 5 of 7