rs11160450 chr14:98341388 A>G
- Sequence
attttggcttcttgcttaactatc[A/G]gcatcttggctcaaagccaatgca
- ASB for transcription factors
- NFIB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFIB_HUMAN | 1.25 | -1.45 | 1.25 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, resistance to kuru in aged women despite likely exposure, rheumatoid arthritis, systolic blood pressure (sbp)