rs11160533 chr14:99609436 C>T
- Sequence
ggcaaacactgaggtccagtgaaa[C/T]aaggattgtccaggaaaccccatg
- ASB in cell types
- HepG2 (hepatoblastoma) glioblastoma patient-derived cell model
- ASB for transcription factors
- CTCF_HUMAN RBM25_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.40 | -2.18 | 1.25 | n/a | No Hit | |||
| RBM25_HUMAN | n/a | 2.70 | 4.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, abnormal involuntary movement scale, bipolar disorder, gender differentiated, early response to treatment in pediatric acute lymphoblastic leukemia treatment, end-of-induction minimal residual disease (pediatric acute lymphoblastic leukemia treatment), methotrexate clearance in pediatric acute lymphoblastic leukemia treatment
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid