rs11160693 chr14:102565494 C>A
- Sequence
aaaaaaaaagatagtgagtgagtt[C/A]taatgagaggtgacggtttcacaa
- ASB in cell types
- monocytes from periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocytes from periferal blood | 1.81 | n/a | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, comorbid depressive syndrome and alcohol dependence, diastolic blood pressure (dbp), systolic blood pressure (sbp), triglycerides