rs11160996 chr14:106618688 T>C
- Sequence
gtgtcctgagcgccccctggtggt[T/C]ctgagagccccctgatgtcctgag
- ASB in cell types
- GM19193 (female B-cells Lymphoblastoid Cell Lines) GM23338 spleen
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | -0.24 | 3.05 | 1.50 | |||
| GM23338 | 3.38 | -3.52 | 1.00 | |||
| spleen | 2.77 | -2.44 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Breast_Mammary_Tissue, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Mucosa, Liver, Lung, Minor_Salivary_Gland, Skin_Not_Sun_Exposed_Suprapubic, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood