rs11162435 chr1:78237548 G>A
- Sequence
gtgttaatgggtgttaacaagggc[G/A]gatttattctacaaacatttaaat
- ASB in cell types
- HUES64 (embryonic stem cells) iPS-derived dermal fibroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUES64 (embryonic stem cells) | -0.86 | 2.08 | 1.50 | |||
| iPS-derived dermal fibroblasts | 0.31 | 1.24 | 1.00 |
Items per page:
1 – 2 of 2