rs11165191 chr1:94654672 T>C
- Sequence
ttaattcctgtattaacctagtaa[T/C]tatacccaattttataagagcaaa
- ASB in cell types
- LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | -0.08 | 0.68 | 1.46 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration, cystatin c in serum, parkinsons disease, total cholesterol change with statins, triglycerides change with statins