rs11166296 chr1:99685920 C>G
- Sequence
agttcatttgaatctgacacgcag[C/G]tgtacactggccaagataccagct
- ASB in cell types
- GM02630 (Fanconi anemi) GM18505 (female B-cells Lymphoblastoid Cell Lines) neural cell GM18486 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02630 (Fanconi anemi) | 0.78 | -0.53 | 1.00 | |||
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | -0.93 | 1.31 | 1.00 | |||
| neural cell | 1.32 | -0.45 | 1.00 | |||
| GM18486 (Lymphoblastoid Cell Lines) | 1.16 | -0.54 | 1.00 |
Items per page:
1 – 4 of 4