rs11166315 chr1:99737287 C>G
- Sequence
agaatcggcttaaaataaatgctg[C/G]cttctgctgatttgacaaaggagc
- ASB in cell types
- GM18951 (B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18951 (B-cells Lymphoblastoid Cell Lines) | 0.04 | 1.91 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Skin_Not_Sun_Exposed_Suprapubic, Small_Intestine_Terminal_Ileum, Spleen, Thyroid, Whole_Blood