rs11167134 chr8:142220168 G>A
- Sequence
agtgagctccacggccatgactga[G/A]tgaggctagacaccgggtgggctg
- ASB for transcription factors
- RBM25_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RBM25_HUMAN | 2.11 | -0.01 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, dental caries, neuroblastoma (brain cancer), parkinsons disease, primary rhegmatogenous retinal detachment, salmonella-induced pyroptosis
GTEx eQTL Adipose_Subcutaneous, Esophagus_Mucosa, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg