rs11168284 chr12:47889266 A>G
- Sequence
gcctggccgagtccagtaccccca[A/G]tcgcctgcctgagcagcttcaggg
- ASB in cell types
- monocyte-derived dendritic cells macrophages form periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived dendritic cells | 1.56 | 0.58 | 1.20 | |||
| macrophages form periferal blood | 0.84 | 2.42 | 2.00 |
Items per page:
1 – 2 of 2